Review



guide rna targeting exon 5  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc guide rna targeting exon 5
    Guide Rna Targeting Exon 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/NFATc4-CRISPR-gRNA%23exon5-(pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0)+(Plasmid+%23124290)/bio_rxiv__2025__04__25__650690-220-3-35
    Average 94 stars, based on 1 article reviews
    guide rna targeting exon 5 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Mitotic phosphorylation of Lamin B1 rod domain by ULK1 and Aurora A/PLK1 promotes spindle function
    Article Snippet: .. For ULK2, a guide RNA targeting exon 5 was generated by hybridization of DNA oligos (5’-CACCGACCTCGCAGATTATTTGCA -3’, 5’-AAACTGCAAATAATCTGCGAGGTC-3’) and cloned into the Bbsl restriction site of the pSpCas9(BB)-2A-GFP (PX458) vector (a gift from Feng Zhang; Addgene plasmid #48138; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). .. PLA was performed using the Duolink® In Situ Detection Reagents Far Red (Sigma-Aldrich #DUO92013) according to the manufactureŕs protocol.

    Hybridization:

    Article Title: Mitotic phosphorylation of Lamin B1 rod domain by ULK1 and Aurora A/PLK1 promotes spindle function
    Article Snippet: .. For ULK2, a guide RNA targeting exon 5 was generated by hybridization of DNA oligos (5’-CACCGACCTCGCAGATTATTTGCA -3’, 5’-AAACTGCAAATAATCTGCGAGGTC-3’) and cloned into the Bbsl restriction site of the pSpCas9(BB)-2A-GFP (PX458) vector (a gift from Feng Zhang; Addgene plasmid #48138; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). .. PLA was performed using the Duolink® In Situ Detection Reagents Far Red (Sigma-Aldrich #DUO92013) according to the manufactureŕs protocol.

    Clone Assay:

    Article Title: Mitotic phosphorylation of Lamin B1 rod domain by ULK1 and Aurora A/PLK1 promotes spindle function
    Article Snippet: .. For ULK2, a guide RNA targeting exon 5 was generated by hybridization of DNA oligos (5’-CACCGACCTCGCAGATTATTTGCA -3’, 5’-AAACTGCAAATAATCTGCGAGGTC-3’) and cloned into the Bbsl restriction site of the pSpCas9(BB)-2A-GFP (PX458) vector (a gift from Feng Zhang; Addgene plasmid #48138; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). .. PLA was performed using the Duolink® In Situ Detection Reagents Far Red (Sigma-Aldrich #DUO92013) according to the manufactureŕs protocol.

    Plasmid Preparation:

    Article Title: Mitotic phosphorylation of Lamin B1 rod domain by ULK1 and Aurora A/PLK1 promotes spindle function
    Article Snippet: .. For ULK2, a guide RNA targeting exon 5 was generated by hybridization of DNA oligos (5’-CACCGACCTCGCAGATTATTTGCA -3’, 5’-AAACTGCAAATAATCTGCGAGGTC-3’) and cloned into the Bbsl restriction site of the pSpCas9(BB)-2A-GFP (PX458) vector (a gift from Feng Zhang; Addgene plasmid #48138; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). .. PLA was performed using the Duolink® In Situ Detection Reagents Far Red (Sigma-Aldrich #DUO92013) according to the manufactureŕs protocol.



    Similar Products

    90
    Macrogen single-guide rna targeting exon 5 of the nlrp3 gene
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Single Guide Rna Targeting Exon 5 Of The Nlrp3 Gene, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/nlrp3+mutants/pmc12085015-105-9-23
    Average 90 stars, based on 1 article reviews
    single-guide rna targeting exon 5 of the nlrp3 gene - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    Addgene inc guide rna targeting exon 5
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Guide Rna Targeting Exon 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/NFATc4-CRISPR-gRNA%23exon5-(pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0)+(Plasmid+%23124290)/bio_rxiv__2025__04__25__650690-220-3-35
    Average 94 stars, based on 1 article reviews
    guide rna targeting exon 5 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Synthego Inc guide rnas (sgrna) targeting exons 5 and 7
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Guide Rnas (Sgrna) Targeting Exons 5 And 7, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/guide+rnas++sgrna++targeting+exons+5+and+7/pm39460794-48-5-22
    Average 90 stars, based on 1 article reviews
    guide rnas (sgrna) targeting exons 5 and 7 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc single guide rnas targeting exons 1, 3 and 5
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Single Guide Rnas Targeting Exons 1, 3 And 5, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/single+guide+rnas+targeting+exons+1++3+and+5/pmc11746146-309-11-33
    Average 90 stars, based on 1 article reviews
    single guide rnas targeting exons 1, 3 and 5 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc chemically modified single guide rna (sgrna) that targets rat g6pd exon 5
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Chemically Modified Single Guide Rna (Sgrna) That Targets Rat G6pd Exon 5, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/synthetic+multi+sgrna+kit+targeting+exon+5+of+the+alpk1+gene/10__1161_slash_jaha__123__035174-50-10-17
    Average 90 stars, based on 1 article reviews
    chemically modified single guide rna (sgrna) that targets rat g6pd exon 5 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Synthego Inc guide rna targeting exon 5
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Guide Rna Targeting Exon 5, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/guide+rna/toutkoushian_hannah_kate__2022__mechanistic_investigation_of_protein_homeostasis_by_two_key_factors_atad1_and_eif2a-377-11-8
    Average 86 stars, based on 1 article reviews
    guide rna targeting exon 5 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Sangon Biotech ampk-targeting single guide (sg) rna sequences (ampk exon 1, sg1: 5′-gaagatcggccactacattc-3′; sg2: 5′- tacattctgggtgacacgct-3′)
    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on <t>NLRP3</t> ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups
    Ampk Targeting Single Guide (Sg) Rna Sequences (Ampk Exon 1, Sg1: 5′ Gaagatcggccactacattc 3′; Sg2: 5′ Tacattctgggtgacacgct 3′), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/ampk+targeting+single+guide++sg++rna+sequences++ampk+exon+1++sg1++5++gaagatcggccactacattc+3+++sg2++5+++tacattctgggtgacacgct+3++/10__1002_slash_jlb__6a0821___409rr-69-1-18
    Average 90 stars, based on 1 article reviews
    ampk-targeting single guide (sg) rna sequences (ampk exon 1, sg1: 5′-gaagatcggccactacattc-3′; sg2: 5′- tacattctgggtgacacgct-3′) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Broad Institute Inc single-guide rna targeting nup210 exon 5
    a Scheme for metastasis susceptibility gene identification. b Circos plot representation of the result in ( a ). Red lines = polymorphic promoter, blue lines = intrachromosomal, and light blue lines = interchromosomal looping interactions. c Distant metastasis-free survival (DMFS) of human ER+ breast cancer patients stratified by their expression of the 52-gene signature. Kaplan–Meier analysis with the log-rank test. d Nup210 mRNA expression in the mouse <t>4T1</t> cell line series. e Integrative Genomics Viewer (IGV) track of the Nup210 promoter BACh region in 4T07 and 4T1 cells. f Polymorphisms within the 510 bp Nup210 promoter region. g 12 bp FVB/NJ promoter indel is located within a CTCF-binding site in mouse Nup210 promoter. h CTCF and H3K27Ac enrichment in human NUP210 promoter of MCF7 cells. i Luciferase assay of BALB/cJ and FVB/NJ Nup210 promoter regions. ANOVA, Tukey’s multiple comparison test, mean ± s.e.m, n = 8 biological replicates. j ChIP analysis of CTCF and H3K27Ac at Nup210 promoter of 4T1 and 6DT1 cells. k Nup210 and Ctcf mRNA levels in cell lines (4T1, 6DT1). Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. l Nup210 and Ctcf mRNA levels in mouse spleen (BALB/cJ or FVB/NJ). Two-tailed t test, mean ± s.e.m, n = 5 mice. m Nup210 and Ctcf mRNA level in Nup210 promoter CTCF-binding site-deleted clones. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. n Effect of Ctcf knockdown on 4T1 Nup210 mRNA levels. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. o Effect of Ctcf knockdown on NUP210 protein level in 4T1 cells.
    Single Guide Rna Targeting Nup210 Exon 5, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/single+guide+rna+targeting+nup210+exon+5/pmc08669001-400-8-31
    Average 90 stars, based on 1 article reviews
    single-guide rna targeting nup210 exon 5 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc guide rna targeting hdac6 exon 5
    Figure 1. <t>HDAC6</t> knockdown (KD) sensitizes several NSCLC cell lines to ionizing radiation (IR). (A) Smaller fractions of viable cells were found in the A549 HDAC6 KD (HD6 KD) cell line as compared to the A549 control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in A549 cells. Right panel: 120 h post-IR, A549 control and HDAC6 stable knockdown cells were suspended in trypan blue. The number of unstained cells (viable), stained cells (non-viable), and total numbers were recorded. Three biological replicates are graphed. Student’s t-tests were performed. * p = 0.0122, ** p = 0.0099, *** p = 0.0021. (B) Smaller fractions of viable cells were found in the H460 HD6 KD cell line as compared to the control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in H460 cells. Right panel: H460 stable HDAC6 knockdown cells were either left untreated, or treated with 10 Gy IR. 120 h later, trypan blue staining was conducted as described in (A). Student’s t tests were performed; * p = 0.0154. (C) Smaller fractions of viable cells were
    Guide Rna Targeting Hdac6 Exon 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+targeting+exon+5/HDAC6+(3C5K)+(Plasmid+%2325243)/pm33020410-41-2-16
    Average 93 stars, based on 1 article reviews
    guide rna targeting hdac6 exon 5 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on NLRP3 ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups

    Journal: Journal of Neuroinflammation

    Article Title: Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    doi: 10.1186/s12974-025-03461-z

    Figure Lengend Snippet: Chemical structure of rebamipide. A Overview of the experimental design. B Protective effects of rebamipide on α-synuclein + MPP + -induced cytotoxicity in BV2 microglia cells. C BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with α-synuclein + MPP + for an additional 11 h. Lactate dehydrogenase (LDH) ( C ), TNF-α ( D ), IL-6 ( E ), IL-1ß ( F , G , and I ), pro-IL-1ß ( H ), and IL-18 ( G ) levels were evaluated. Inhibitory effects of rebamipide on NLRP3 ( J ), ASC ( K ), pro-caspase-1 ( L ), and p20 ( M ) in BV2 microglia cells were measured using ELISA. Molecular docking illustrating the binding interactions of rebamipide with the NLRP3-NEK7 complex and NLRP3 alone ( N ). The left panels depict 3D docking models, whereas the right panels represent 2D interaction diagrams highlighting key binding residues. Hydrogen bonds are indicated by purple arrows, halogen bonds by yellow arrows, and salt bridges by red and blue lines. Rebamipide interacts with ASN978, TYR1009, and PRO1034 of NLRP3 and LYS163 of NEK7, suggesting a role in disrupting the NLRP3-NEK7 interaction and modulating inflammasome activation. Surface plasmon resonance (SPR) sensorgrams demonstrating the real-time binding kinetics of rebamipide to NLRP3-NEK7 complex ( O ) and NLRP3 alone ( P ). Rebamipide exhibited dose-dependent binding, with a higher binding affinity for NLRP3-NEK7 complex than NLRP3 alone. Overview of the experimental design ( Q ). Inhibitory effects of rebamipide on NLRP3-induced upregulation of IL-1ß ( R ) and IL-18 ( S ) in BV2 microglia cells. BV2 microglia cells were treated with rebamipide for 1 h and then stimulated with MSU, nigericine, ATP, and hemozoin for an additional 11 h. IL-1ß and IL-18 levels were evaluated ( T - X ). Data are presented as mean ± standard error of mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or NLRP3 inducers-treated groups

    Article Snippet: A single-guide RNA (sgRNA) targeting exon 5 of the NLRP3 gene and Cas9 protein tagged with a nuclear localization signal were procured from Macrogen, Inc. to generate NLRP3 KO mice (Fig. A).

    Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Activation Assay, SPR Assay, Control

    NLRP3 inhibition neutralizes the protective effect of rebamipide following α-synuclein + MPP + intoxication. Overview of the experimental design. A BV2 microglia cells were treated with NLRP3 inflammasome inhibitor (MCC950) for 6 h, treated with rebamipide for 1 h, and stimulated with α-synuclein + MPP + for an additional 11 h. IL-1ß ( B ) and IL-18 ( C ) levels were evaluated using enzyme-linked immunosorbent assay kits (ELISA). Overview of the experimental design ( D ). Effects of NLRP3 on IL-1ß and IL-18 regulation ( E ) in NLRP3 siRNA-transfected BV2 microglia cells. NLRP3 inhibition neutralized the protective effect of rebamipide following 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) intoxication. An MCC950 or saline was injected once daily in the MPTP intoxication model before rebamipide treatment. Overview of the experimental design. F Microglial activations were visualized 3 d after the last MPTP treatment using Iba-1-specific immunostaining. Iba-1-immunopositive microglia in the substantia nigra pars compacta (SNpc) were counted 3 d after the last MPTP treatment (G and N). IL-1ß (H) and IL-18 ( I ) levels were evaluated using enzyme-linked immunosorbent assays (ELISA). Moreover, dopaminergic neurons were visualized 7 d after MPTP injection, using tyrosine hydroxylase (TH)-specific immunostaining. TH-immunopositive neurons in the SNpc ( J and O ) were counted, and the relative TH fluorescence intensity in the striatum (ST) ( K and O ) was measured. Dopamine levels in the ST were measured using HPLC ( L ). Latency time on the rotarod was recorded 7 d post-MPTP injection, with a 300 s cutoff limit ( M ). Data are expressed as mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or MPTP-treated group

    Journal: Journal of Neuroinflammation

    Article Title: Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    doi: 10.1186/s12974-025-03461-z

    Figure Lengend Snippet: NLRP3 inhibition neutralizes the protective effect of rebamipide following α-synuclein + MPP + intoxication. Overview of the experimental design. A BV2 microglia cells were treated with NLRP3 inflammasome inhibitor (MCC950) for 6 h, treated with rebamipide for 1 h, and stimulated with α-synuclein + MPP + for an additional 11 h. IL-1ß ( B ) and IL-18 ( C ) levels were evaluated using enzyme-linked immunosorbent assay kits (ELISA). Overview of the experimental design ( D ). Effects of NLRP3 on IL-1ß and IL-18 regulation ( E ) in NLRP3 siRNA-transfected BV2 microglia cells. NLRP3 inhibition neutralized the protective effect of rebamipide following 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) intoxication. An MCC950 or saline was injected once daily in the MPTP intoxication model before rebamipide treatment. Overview of the experimental design. F Microglial activations were visualized 3 d after the last MPTP treatment using Iba-1-specific immunostaining. Iba-1-immunopositive microglia in the substantia nigra pars compacta (SNpc) were counted 3 d after the last MPTP treatment (G and N). IL-1ß (H) and IL-18 ( I ) levels were evaluated using enzyme-linked immunosorbent assays (ELISA). Moreover, dopaminergic neurons were visualized 7 d after MPTP injection, using tyrosine hydroxylase (TH)-specific immunostaining. TH-immunopositive neurons in the SNpc ( J and O ) were counted, and the relative TH fluorescence intensity in the striatum (ST) ( K and O ) was measured. Dopamine levels in the ST were measured using HPLC ( L ). Latency time on the rotarod was recorded 7 d post-MPTP injection, with a 300 s cutoff limit ( M ). Data are expressed as mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the α-synuclein + MPP + or MPTP-treated group

    Article Snippet: A single-guide RNA (sgRNA) targeting exon 5 of the NLRP3 gene and Cas9 protein tagged with a nuclear localization signal were procured from Macrogen, Inc. to generate NLRP3 KO mice (Fig. A).

    Techniques: Inhibition, Enzyme-linked Immunosorbent Assay, Transfection, Saline, Injection, Immunostaining, Fluorescence, Control

    NLRP3 KO using CRISPR/Cas9 neutralizes the protective effect of rebamipide following 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) intoxication. Schematic of the NLRP3 KO using CRISPR/Cas9 ( A ) Sequences for CRISPR-Cas9 ( B ) and primer sequences for real-time RT-PCR ( C ) NLRP3 KO (hetero or homo) was confirmed using real-time PCR ( D ) Overview of the experimental design ( E ). Inhibitory effects of rebamipide on MPTP-induced levels of IL-1ß ( E ), IL-18 ( F ), and microglia activation ( G and H ) in the substantia nigra pars compacta (SNpc) 3 d after MPTP injection. Moreover, dopaminergic neurons were visualized using tyrosine hydroxylase (TH)-specific immunostaining 7 d after the last MPTP treatment. TH-immunopositive neurons in the SNpc were counted ( I ), and the relative TH fluorescence intensity in the striatum (ST) was measured ( J ). Dopamine levels in the ST were measured using HPLC ( K ). Representative photomicrographs of the SNpc and ST ( L ). Data are expressed as mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the MPTP-treated group

    Journal: Journal of Neuroinflammation

    Article Title: Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    doi: 10.1186/s12974-025-03461-z

    Figure Lengend Snippet: NLRP3 KO using CRISPR/Cas9 neutralizes the protective effect of rebamipide following 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) intoxication. Schematic of the NLRP3 KO using CRISPR/Cas9 ( A ) Sequences for CRISPR-Cas9 ( B ) and primer sequences for real-time RT-PCR ( C ) NLRP3 KO (hetero or homo) was confirmed using real-time PCR ( D ) Overview of the experimental design ( E ). Inhibitory effects of rebamipide on MPTP-induced levels of IL-1ß ( E ), IL-18 ( F ), and microglia activation ( G and H ) in the substantia nigra pars compacta (SNpc) 3 d after MPTP injection. Moreover, dopaminergic neurons were visualized using tyrosine hydroxylase (TH)-specific immunostaining 7 d after the last MPTP treatment. TH-immunopositive neurons in the SNpc were counted ( I ), and the relative TH fluorescence intensity in the striatum (ST) was measured ( J ). Dopamine levels in the ST were measured using HPLC ( K ). Representative photomicrographs of the SNpc and ST ( L ). Data are expressed as mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the MPTP-treated group

    Article Snippet: A single-guide RNA (sgRNA) targeting exon 5 of the NLRP3 gene and Cas9 protein tagged with a nuclear localization signal were procured from Macrogen, Inc. to generate NLRP3 KO mice (Fig. A).

    Techniques: CRISPR, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Activation Assay, Injection, Immunostaining, Fluorescence, Control

    NLRP3 KO neutralizes rebamipide’s protective effects on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced motor impairment in Cas9 Ctrl and NLRP3 KO mice. Representative images of mouse movement in the open field box, as captured by the video tracking system. The total distance covered by the mice was quantified in the open field box 7 d after MPTP injection ( A and E ), and the latency time on the rotarod was recorded, with a 300 s cutoff limit ( B ). Moreover, the time it took to turn completely downward ( C ) and the time to fall off the rod onto the floor ( D ) were recorded 7 d postinjection, with a 60 s cutoff limit. Data are presented as the mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the MPTP-treated group

    Journal: Journal of Neuroinflammation

    Article Title: Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    doi: 10.1186/s12974-025-03461-z

    Figure Lengend Snippet: NLRP3 KO neutralizes rebamipide’s protective effects on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced motor impairment in Cas9 Ctrl and NLRP3 KO mice. Representative images of mouse movement in the open field box, as captured by the video tracking system. The total distance covered by the mice was quantified in the open field box 7 d after MPTP injection ( A and E ), and the latency time on the rotarod was recorded, with a 300 s cutoff limit ( B ). Moreover, the time it took to turn completely downward ( C ) and the time to fall off the rod onto the floor ( D ) were recorded 7 d postinjection, with a 60 s cutoff limit. Data are presented as the mean ± standard error of the mean (SEM). * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the MPTP-treated group

    Article Snippet: A single-guide RNA (sgRNA) targeting exon 5 of the NLRP3 gene and Cas9 protein tagged with a nuclear localization signal were procured from Macrogen, Inc. to generate NLRP3 KO mice (Fig. A).

    Techniques: Injection, Control

    Proposed mechanism through which rebamipide protects via NLRP3 inhibition against Parkinson’s disease pathogenesis. Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    Journal: Journal of Neuroinflammation

    Article Title: Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    doi: 10.1186/s12974-025-03461-z

    Figure Lengend Snippet: Proposed mechanism through which rebamipide protects via NLRP3 inhibition against Parkinson’s disease pathogenesis. Rebamipide (Mucosta®), a clinically approved drug, alleviates neuroinflammation and dopaminergic neurodegeneration in a Parkinson’s disease model

    Article Snippet: A single-guide RNA (sgRNA) targeting exon 5 of the NLRP3 gene and Cas9 protein tagged with a nuclear localization signal were procured from Macrogen, Inc. to generate NLRP3 KO mice (Fig. A).

    Techniques: Inhibition

    a Scheme for metastasis susceptibility gene identification. b Circos plot representation of the result in ( a ). Red lines = polymorphic promoter, blue lines = intrachromosomal, and light blue lines = interchromosomal looping interactions. c Distant metastasis-free survival (DMFS) of human ER+ breast cancer patients stratified by their expression of the 52-gene signature. Kaplan–Meier analysis with the log-rank test. d Nup210 mRNA expression in the mouse 4T1 cell line series. e Integrative Genomics Viewer (IGV) track of the Nup210 promoter BACh region in 4T07 and 4T1 cells. f Polymorphisms within the 510 bp Nup210 promoter region. g 12 bp FVB/NJ promoter indel is located within a CTCF-binding site in mouse Nup210 promoter. h CTCF and H3K27Ac enrichment in human NUP210 promoter of MCF7 cells. i Luciferase assay of BALB/cJ and FVB/NJ Nup210 promoter regions. ANOVA, Tukey’s multiple comparison test, mean ± s.e.m, n = 8 biological replicates. j ChIP analysis of CTCF and H3K27Ac at Nup210 promoter of 4T1 and 6DT1 cells. k Nup210 and Ctcf mRNA levels in cell lines (4T1, 6DT1). Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. l Nup210 and Ctcf mRNA levels in mouse spleen (BALB/cJ or FVB/NJ). Two-tailed t test, mean ± s.e.m, n = 5 mice. m Nup210 and Ctcf mRNA level in Nup210 promoter CTCF-binding site-deleted clones. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. n Effect of Ctcf knockdown on 4T1 Nup210 mRNA levels. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. o Effect of Ctcf knockdown on NUP210 protein level in 4T1 cells.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Scheme for metastasis susceptibility gene identification. b Circos plot representation of the result in ( a ). Red lines = polymorphic promoter, blue lines = intrachromosomal, and light blue lines = interchromosomal looping interactions. c Distant metastasis-free survival (DMFS) of human ER+ breast cancer patients stratified by their expression of the 52-gene signature. Kaplan–Meier analysis with the log-rank test. d Nup210 mRNA expression in the mouse 4T1 cell line series. e Integrative Genomics Viewer (IGV) track of the Nup210 promoter BACh region in 4T07 and 4T1 cells. f Polymorphisms within the 510 bp Nup210 promoter region. g 12 bp FVB/NJ promoter indel is located within a CTCF-binding site in mouse Nup210 promoter. h CTCF and H3K27Ac enrichment in human NUP210 promoter of MCF7 cells. i Luciferase assay of BALB/cJ and FVB/NJ Nup210 promoter regions. ANOVA, Tukey’s multiple comparison test, mean ± s.e.m, n = 8 biological replicates. j ChIP analysis of CTCF and H3K27Ac at Nup210 promoter of 4T1 and 6DT1 cells. k Nup210 and Ctcf mRNA levels in cell lines (4T1, 6DT1). Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. l Nup210 and Ctcf mRNA levels in mouse spleen (BALB/cJ or FVB/NJ). Two-tailed t test, mean ± s.e.m, n = 5 mice. m Nup210 and Ctcf mRNA level in Nup210 promoter CTCF-binding site-deleted clones. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. n Effect of Ctcf knockdown on 4T1 Nup210 mRNA levels. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. o Effect of Ctcf knockdown on NUP210 protein level in 4T1 cells.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Expressing, Binding Assay, Luciferase, Comparison, Two Tailed Test, Clone Assay, Knockdown

    a Western blot of Nup210 knockdown (KD) in 4T1 cells. b Primary tumor weight, c representative lung images, and d lung metastases count and lung metastases count normalized to primary tumor weight in orthotopically transplanted Nup210 KD 4T1 cells. ANOVA with Tukey’s multiple comparison test, mean ± s.d. sh-Ctrl, n = 10; sh # 1, n = 10; sh # 4, n = 9 mice. e Western blot showing CRISPR/Cas9-mediated knockout (KO) of Nup210 in 4T1 cells. f Primary tumor weight, g representative lung images, h lung metastases count and tumor-normalized metastases count after orthotopic transplantation of Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison test, mean ± s.d. n = 10 mice per group. i DNA content analysis with EdU incorporation of the different stages of the cell cycle in sg-Ctrl and Nup210 KO 4T1 cells. j Quantification of cell cycle stage distribution in sg-Ctrl and Nup210 KO 4T1 cells.Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. k Western blot (left) and qRT-PCR (right) of NUP210 overexpression in 4T1 cells. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. l Primary tumor weight, m representative lung images, and n lung metastases count after orthotopic transplantation of NUP210-overexpressing 4T1 cells. Mann–Whitney U test, mean ± s.d. n = 10 mice per group.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Western blot of Nup210 knockdown (KD) in 4T1 cells. b Primary tumor weight, c representative lung images, and d lung metastases count and lung metastases count normalized to primary tumor weight in orthotopically transplanted Nup210 KD 4T1 cells. ANOVA with Tukey’s multiple comparison test, mean ± s.d. sh-Ctrl, n = 10; sh # 1, n = 10; sh # 4, n = 9 mice. e Western blot showing CRISPR/Cas9-mediated knockout (KO) of Nup210 in 4T1 cells. f Primary tumor weight, g representative lung images, h lung metastases count and tumor-normalized metastases count after orthotopic transplantation of Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison test, mean ± s.d. n = 10 mice per group. i DNA content analysis with EdU incorporation of the different stages of the cell cycle in sg-Ctrl and Nup210 KO 4T1 cells. j Quantification of cell cycle stage distribution in sg-Ctrl and Nup210 KO 4T1 cells.Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. k Western blot (left) and qRT-PCR (right) of NUP210 overexpression in 4T1 cells. Two-tailed t test, mean ± s.e.m, n = 3 biological replicates. l Primary tumor weight, m representative lung images, and n lung metastases count after orthotopic transplantation of NUP210-overexpressing 4T1 cells. Mann–Whitney U test, mean ± s.d. n = 10 mice per group.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Western Blot, Knockdown, Comparison, CRISPR, Knock-Out, Transplantation Assay, Two Tailed Test, Quantitative RT-PCR, Over Expression, MANN-WHITNEY

    a NUP210 coimmunoprecipitation (Co-IP)-LC-MS analysis. b Peptide count in LC-MS analysis with endogenous and Myc-tag-NUP210 antibodies. c Association of histone H3.1 amplification on the overall survival of breast cancer patients. d Co-IP of NUP210-Myc with H3.1/3.2 in 4T1 cells. e Co-IP of endogenous H3.1/3.2, NUP210, and Lamin B1 in 4T1 cells. f Reciprocal Co-IP of Flag-H3.1 and NUP210-Myc in HEK293FT cells. g Representative immunofluorescence images of H3.1/3.2 and NUP210-Myc localization in 4T1 cells. Scale bar = 5 μm. h Representative images of H3.1/3.2 and H3K27me3 in sg-Ctrl and Nup210 KO 4T1 cells. Scale bar = 5 μm. i H3.1/3.2 and H3K27me3 nuclear periphery vs total nuclear intensity ratio in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with interquartile range. ‘ n ’ equals the number of cells analyzed. j Representative images of H3.1/3.2 localization with H3K9me3 in Nup210 KO 4T1 cells. Scale bar = 5 μm. k (Left) H3.1/3.2 (heterochromatin foci vs total nucleus) and (Right) H3K9me3 (periphery vs total nuclear intensity) intensity ratios in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with interquartile range. ‘ n ’ equals the number of cells analyzed. l 3D reconstruction of H3.1/3.2 and H3K9me3 distribution in Nup210 KO 4T1 cells. The intensity was adjusted to visualize distinct foci. Scale bar = 2 μm. m Representative images of H3.1/3.2 distribution at the nucleolar (nucleolin) periphery in Nup210 KO 4T1 cells. Scale bar = 5 μm. n Live-cell imaging of nuclear size of Nup210 KO 4T1 cells before and after mitosis. Thin line, single nuclear size traces; thick line, median of nuclear size, box plot represents average nuclear size. ‘ n ’ equals the number of cells analyzed per condition. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test. The box represents 25th to 75th percentile, the whiskers represent the data range, and the horizontal line represents the median. o Co-IP of H3.1/3.2 with Lamin B1, SUV39H1, and H3K9me3 in Nup210 KO 4T1 cells. p Co-IP of H3.1/3.2 with EZH2; q EZH2 and SUZ12; r EZH2 and H3K27me3 in Nup210 KO 4T1 cells.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a NUP210 coimmunoprecipitation (Co-IP)-LC-MS analysis. b Peptide count in LC-MS analysis with endogenous and Myc-tag-NUP210 antibodies. c Association of histone H3.1 amplification on the overall survival of breast cancer patients. d Co-IP of NUP210-Myc with H3.1/3.2 in 4T1 cells. e Co-IP of endogenous H3.1/3.2, NUP210, and Lamin B1 in 4T1 cells. f Reciprocal Co-IP of Flag-H3.1 and NUP210-Myc in HEK293FT cells. g Representative immunofluorescence images of H3.1/3.2 and NUP210-Myc localization in 4T1 cells. Scale bar = 5 μm. h Representative images of H3.1/3.2 and H3K27me3 in sg-Ctrl and Nup210 KO 4T1 cells. Scale bar = 5 μm. i H3.1/3.2 and H3K27me3 nuclear periphery vs total nuclear intensity ratio in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with interquartile range. ‘ n ’ equals the number of cells analyzed. j Representative images of H3.1/3.2 localization with H3K9me3 in Nup210 KO 4T1 cells. Scale bar = 5 μm. k (Left) H3.1/3.2 (heterochromatin foci vs total nucleus) and (Right) H3K9me3 (periphery vs total nuclear intensity) intensity ratios in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with interquartile range. ‘ n ’ equals the number of cells analyzed. l 3D reconstruction of H3.1/3.2 and H3K9me3 distribution in Nup210 KO 4T1 cells. The intensity was adjusted to visualize distinct foci. Scale bar = 2 μm. m Representative images of H3.1/3.2 distribution at the nucleolar (nucleolin) periphery in Nup210 KO 4T1 cells. Scale bar = 5 μm. n Live-cell imaging of nuclear size of Nup210 KO 4T1 cells before and after mitosis. Thin line, single nuclear size traces; thick line, median of nuclear size, box plot represents average nuclear size. ‘ n ’ equals the number of cells analyzed per condition. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test. The box represents 25th to 75th percentile, the whiskers represent the data range, and the horizontal line represents the median. o Co-IP of H3.1/3.2 with Lamin B1, SUV39H1, and H3K9me3 in Nup210 KO 4T1 cells. p Co-IP of H3.1/3.2 with EZH2; q EZH2 and SUZ12; r EZH2 and H3K27me3 in Nup210 KO 4T1 cells.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Co-Immunoprecipitation Assay, Liquid Chromatography with Mass Spectroscopy, Amplification, Immunofluorescence, MANN-WHITNEY, Live Cell Imaging, Comparison

    a H3K27me3 peak enrichment on gene bodies in Nup210 KO cells within NUP210-enriched regions. b H3K27me3 ChIP-seq profile in sg-Ctrl and Nup210 KO cells. c H3K4me3 ChIP-seq profile on gene promoters in sg-Ctrl and Nup210 KO cells. d Overlap of genes with H3K4me3 loss on the promoter and downregulated expression in Nup210 KD cells. e Gene Ontology (GO) analysis of overlapped genes from ( d ). f qRT-PCR analysis of cell migration-related genes in Nup210 KO and KD 4T1 cells. Multiple two-tailed t test, mean ± s.e.m, n = 3 biological replicates (sg-ctrl vs Nup210 KO), n = 4 biological replicates (sh-Ctrl vs sh-Nup210). g Representative ChIP-seq (NUP210-, H3K27Ac-, H3K27me3- and H3K4me3) tracks with predicted TADs within Cxcl and Ccl2 region. h qRT-PCR analysis of cell migration-related genes in DMSO- and GSK126-treated Nup210 KO 4T1 cells. Multiple two-tailed t test, mean ± s.e.m, n = 3 biological replicates. i Representative images of H3.1/3.2 and H3K27me3 distribution in DMSO- and GSK126-treated Nup210 KO cells. Scale bar = 5 μm. j H3.1/3.2 intensity ratio, H3K27me3 intensity and nuclear area quantification in DMSO- and GSK126-treated Nup210 KO 4T1 cells. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test, error bar represents median with interquartile range. ‘ n ’ in X -axis is the number of cells analyzed per condition. k Live-cell tracking of a nuclear area in DMSO- and GSK126-treated Nup210 KO cells. n = 40 (sg-Ctrl), n = 41 (KO + DMSO), and n = 31 cells analyzed per conditions.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a H3K27me3 peak enrichment on gene bodies in Nup210 KO cells within NUP210-enriched regions. b H3K27me3 ChIP-seq profile in sg-Ctrl and Nup210 KO cells. c H3K4me3 ChIP-seq profile on gene promoters in sg-Ctrl and Nup210 KO cells. d Overlap of genes with H3K4me3 loss on the promoter and downregulated expression in Nup210 KD cells. e Gene Ontology (GO) analysis of overlapped genes from ( d ). f qRT-PCR analysis of cell migration-related genes in Nup210 KO and KD 4T1 cells. Multiple two-tailed t test, mean ± s.e.m, n = 3 biological replicates (sg-ctrl vs Nup210 KO), n = 4 biological replicates (sh-Ctrl vs sh-Nup210). g Representative ChIP-seq (NUP210-, H3K27Ac-, H3K27me3- and H3K4me3) tracks with predicted TADs within Cxcl and Ccl2 region. h qRT-PCR analysis of cell migration-related genes in DMSO- and GSK126-treated Nup210 KO 4T1 cells. Multiple two-tailed t test, mean ± s.e.m, n = 3 biological replicates. i Representative images of H3.1/3.2 and H3K27me3 distribution in DMSO- and GSK126-treated Nup210 KO cells. Scale bar = 5 μm. j H3.1/3.2 intensity ratio, H3K27me3 intensity and nuclear area quantification in DMSO- and GSK126-treated Nup210 KO 4T1 cells. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test, error bar represents median with interquartile range. ‘ n ’ in X -axis is the number of cells analyzed per condition. k Live-cell tracking of a nuclear area in DMSO- and GSK126-treated Nup210 KO cells. n = 40 (sg-Ctrl), n = 41 (KO + DMSO), and n = 31 cells analyzed per conditions.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: ChIP-sequencing, Expressing, Quantitative RT-PCR, Migration, Two Tailed Test, Comparison, Cell Tracking Assay

    a Representative brightfield images of 4T1 Nup210 KO cells on type I collagen and fibronectin. Scale bar = 100 μm. b Representative images of p-FAK (Y397) focal adhesions and F-actin in sg-Ctrl and Nup210 KO cells on type I collagen and fibronectin. Scale bar = 10 μm. c Quantification of focal adhesion area, count, and cell spreading in sg-Ctrl and Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison correction. The box represents the 25th to 75th percentile, whiskers represent data range, and the horizontal line represents the median. d (Left) Immunostaining of Nup210 KO (KO-N13) 4T1 primary tumors with p-FAK Y397 and pan-cytokeratin (Pan-CK) antibodies. Scale bar = 50 μm. (Right) quantification of p-FAK Y397 signal in the Pan-CK-stained tumor area. N = 5 mice per condition, ~10 independent fields per mouse tumor section. Mann–Whitney U test, median with interquartile range. e Western blot of myc-tagged FAK overexpression in Nup210 KO 4T1 cells. f Primary tumor weight in FAK-overexpressing Nup210 KO (KO-N13) 4T1 cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. n = 10 mice per group. g Representative lung images of the mice injected with FAK-overexpressing Nup210 KO cells. h Lung metastasis count and metastases normalized to tumor weight in FAK-overexpressing Nup210 KO cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. n = 10 mice per group. i Metastasis incidence in mice injected with FAK-overexpressing Nup210 KO cells. χ 2 test with Bonferroni correction. n = 10 mice per group.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Representative brightfield images of 4T1 Nup210 KO cells on type I collagen and fibronectin. Scale bar = 100 μm. b Representative images of p-FAK (Y397) focal adhesions and F-actin in sg-Ctrl and Nup210 KO cells on type I collagen and fibronectin. Scale bar = 10 μm. c Quantification of focal adhesion area, count, and cell spreading in sg-Ctrl and Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison correction. The box represents the 25th to 75th percentile, whiskers represent data range, and the horizontal line represents the median. d (Left) Immunostaining of Nup210 KO (KO-N13) 4T1 primary tumors with p-FAK Y397 and pan-cytokeratin (Pan-CK) antibodies. Scale bar = 50 μm. (Right) quantification of p-FAK Y397 signal in the Pan-CK-stained tumor area. N = 5 mice per condition, ~10 independent fields per mouse tumor section. Mann–Whitney U test, median with interquartile range. e Western blot of myc-tagged FAK overexpression in Nup210 KO 4T1 cells. f Primary tumor weight in FAK-overexpressing Nup210 KO (KO-N13) 4T1 cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. n = 10 mice per group. g Representative lung images of the mice injected with FAK-overexpressing Nup210 KO cells. h Lung metastasis count and metastases normalized to tumor weight in FAK-overexpressing Nup210 KO cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. n = 10 mice per group. i Metastasis incidence in mice injected with FAK-overexpressing Nup210 KO cells. χ 2 test with Bonferroni correction. n = 10 mice per group.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Comparison, Immunostaining, Staining, MANN-WHITNEY, Western Blot, Over Expression, Injection

    a Representative images of 4T1 cells on fibronectin-coated hydrogel layers of soft (0.2 kPa) and stiff (12 kPa) matrices. Scale bar = 10 μm. b (Left) Western blot of NUP210, p-FAK Y397, and T-FAK (Total FAK) proteins of 4T1 cells grown on soft or stiff matrices. (Right) Quantification of signals normalized to T-FAK intensity. c qRT-PCR of Nup210 -regulated and known mechanosensitive genes ( Ier3 , Mrtf-a , and Yap1 ) genes in soft and stiff matrices. Multiple two-tailed t test, mean ± s.e.m. n = 3 biological replicates. d Morphology of sh-Ctrl and Nup210 KD 4T1 cells in soft and stiff matrices. Scale bar = 10 μm. e Live-cell imaging of F-tractin-MLC2 reporter transduced 6DT1 sh-Nup210 cells. Cells were treated with cytochalasin D for 1 h and imaged overnight after drug washout. Scale bar = 10 μm. f (Left) cell migration tracks (red) of sg-Ctrl and Nup210 KO 4T1 cells. (Right) Quantification of cell speed. Kruskal–Wallis ANOVA with Dunn’s multiple comparison correction, sg-Ctrl ( n = 847 cells), KO-N9 ( n = 124 cells), KO-N13 ( n = 375 cells), error bar represents median with interquartile range. g Quantification (left) and representative images (right) of cell invasion for 4T1 (at 48 h) and ( h ) 6DT1 (at 24 h) NUP210-depleted cells. Two-tailed t test, mean ± s.d. n = 3 biological replicates. Scale bar = 100 μm.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Representative images of 4T1 cells on fibronectin-coated hydrogel layers of soft (0.2 kPa) and stiff (12 kPa) matrices. Scale bar = 10 μm. b (Left) Western blot of NUP210, p-FAK Y397, and T-FAK (Total FAK) proteins of 4T1 cells grown on soft or stiff matrices. (Right) Quantification of signals normalized to T-FAK intensity. c qRT-PCR of Nup210 -regulated and known mechanosensitive genes ( Ier3 , Mrtf-a , and Yap1 ) genes in soft and stiff matrices. Multiple two-tailed t test, mean ± s.e.m. n = 3 biological replicates. d Morphology of sh-Ctrl and Nup210 KD 4T1 cells in soft and stiff matrices. Scale bar = 10 μm. e Live-cell imaging of F-tractin-MLC2 reporter transduced 6DT1 sh-Nup210 cells. Cells were treated with cytochalasin D for 1 h and imaged overnight after drug washout. Scale bar = 10 μm. f (Left) cell migration tracks (red) of sg-Ctrl and Nup210 KO 4T1 cells. (Right) Quantification of cell speed. Kruskal–Wallis ANOVA with Dunn’s multiple comparison correction, sg-Ctrl ( n = 847 cells), KO-N9 ( n = 124 cells), KO-N13 ( n = 375 cells), error bar represents median with interquartile range. g Quantification (left) and representative images (right) of cell invasion for 4T1 (at 48 h) and ( h ) 6DT1 (at 24 h) NUP210-depleted cells. Two-tailed t test, mean ± s.d. n = 3 biological replicates. Scale bar = 100 μm.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Western Blot, Quantitative RT-PCR, Two Tailed Test, Live Cell Imaging, Migration, Comparison

    a Coimmunoprecipitation of myc-tagged NUP210 with SUN1 and SUN2. b Colocalization of SUN2 and myc-tagged NUP210. Scale bar = 5 μm. c Distribution of SUN1 and SUN2 in Nup210 KO (KO-N13) 4T1 cells. Scale bar = 10 μm. d Quantification of SUN2 and SUN1 intensity in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. e Distribution of Lamin B1 and Lamin A/C in Nup210 KO 4T1 cells. MIP maximum intensity projection. Scale bar = 5 μm. f Quantification of Lamin B1 and Lamin A/C intensity in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. g 3D reconstruction of Lamin B1, Lamin A/C, and DAPI (heterochromatin foci) distribution in Nup210 KO 4T1 cells. Scale bar = 2 μm. h Subcellular fractionation of LINC complex proteins and mechanosensitive MRTF-A and YAP in Nup210 KO 4T1 cells. i Co-IP of H3.1/3.2 with LINC complex proteins SUN2, BRD4 short isoform (BRD4-SF), and RRP1B in 4T1 cells. j Co-IP of V5-tagged BRD4-SF with NUP210 in 4T1 cells. k Co-IP of H3.1/3.2 and SUN2 in human MCF7 and MDA-MB-231 cell line. l Co-IP of H3.1/3.2 with NUP210 and SUN2 in JQ1-treated 4T1 cells. m Distribution of H3.1/3.2 and H3K27me3 in 4T1 cells treated with bromodomain inhibitor JQ1. Scale bar = 5 μm. n Quantification of H3.1/3.2 and H3K27me3 intensity in JQ1-treated 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. o Live-cell tracking of nuclear size in DMSO control ( n = 122) and JQ1-treated 4T1 cells ( n = 127). p qRT-PCR of NUP210-regulated genes in JQ1-treated 4T1 cells. Two-tailed t test, mean ± s.e.m. n = 3 biological replicates. q qRT-PCR of NUP210-regulated genes in BRD4-SF knockdown 4T1 cells. Two-tailed t test, mean ± s.e.m. n = 3.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Coimmunoprecipitation of myc-tagged NUP210 with SUN1 and SUN2. b Colocalization of SUN2 and myc-tagged NUP210. Scale bar = 5 μm. c Distribution of SUN1 and SUN2 in Nup210 KO (KO-N13) 4T1 cells. Scale bar = 10 μm. d Quantification of SUN2 and SUN1 intensity in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. e Distribution of Lamin B1 and Lamin A/C in Nup210 KO 4T1 cells. MIP maximum intensity projection. Scale bar = 5 μm. f Quantification of Lamin B1 and Lamin A/C intensity in Nup210 KO 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. g 3D reconstruction of Lamin B1, Lamin A/C, and DAPI (heterochromatin foci) distribution in Nup210 KO 4T1 cells. Scale bar = 2 μm. h Subcellular fractionation of LINC complex proteins and mechanosensitive MRTF-A and YAP in Nup210 KO 4T1 cells. i Co-IP of H3.1/3.2 with LINC complex proteins SUN2, BRD4 short isoform (BRD4-SF), and RRP1B in 4T1 cells. j Co-IP of V5-tagged BRD4-SF with NUP210 in 4T1 cells. k Co-IP of H3.1/3.2 and SUN2 in human MCF7 and MDA-MB-231 cell line. l Co-IP of H3.1/3.2 with NUP210 and SUN2 in JQ1-treated 4T1 cells. m Distribution of H3.1/3.2 and H3K27me3 in 4T1 cells treated with bromodomain inhibitor JQ1. Scale bar = 5 μm. n Quantification of H3.1/3.2 and H3K27me3 intensity in JQ1-treated 4T1 cells. Mann–Whitney U test, error bar represents median with an interquartile range. ‘ n ’ equals the number of cells analyzed. o Live-cell tracking of nuclear size in DMSO control ( n = 122) and JQ1-treated 4T1 cells ( n = 127). p qRT-PCR of NUP210-regulated genes in JQ1-treated 4T1 cells. Two-tailed t test, mean ± s.e.m. n = 3 biological replicates. q qRT-PCR of NUP210-regulated genes in BRD4-SF knockdown 4T1 cells. Two-tailed t test, mean ± s.e.m. n = 3.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: MANN-WHITNEY, Fractionation, Co-Immunoprecipitation Assay, Cell Tracking Assay, Control, Quantitative RT-PCR, Two Tailed Test, Knockdown

    a Cytokine analysis and quantification of boxed cytokines of supernatants from sh-Ctrl and Nup210 KD 4T1 cells. b qRT-PCR analysis of Ccl2 KD in 4T1 cells. c Western blot of p-FAK Y397 and T-FAK proteins in Ccl2 KD 4T1 cells. d p-FAK (Y397) focal adhesion and F-actin distribution in sh-Ctrl and Ccl2 KD 4T1 cells. Scale bar = 10 μm. e Quantification of focal adhesion area, count, and cell spreading in sh-Ctrl and Ccl2 KD 4T1 cells. ANOVA with Tukey’s multiple comparison correction, box represents 25th to 75th percentile, whiskers represent data range, and the horizontal line represents median. ‘ n ’ equals the number of cells analyzed. f Cell migration tracks and quantification of sh-Ctrl and Ccl2 KD 4T1 cells. Average cell speed analyzed by ANOVA with Dunnet’s multiple comparison test, mean ± s.e.m. ‘ n ’ equals the number of independent replicates. g Brightfield images and quantification of cell area of 4T1 Nup210 KO cells treated with Ccl2. ANOVA with Tukey’s multiple comparison correction, box represents 25th to 75th percentile, whiskers represent data range, and the horizontal line represents median. ‘ n ’ equals the number of cells analyzed. h Western blot and signal quantification of Ccl2 overexpression in Nup210 KO 4T1 cells. i Tumor weight of mice injected with Ccl2 -overexpressing Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. For sg-Ctrl+Ctrl-OE and Nup KO + Ctrl-OE, n = 10 mice; for Nup KO + Ccl2-OE, n = 9 mice. ( j ) Representative lung images from the mice from ( i ). k Lung metastases count and metastasis normalized to tumor weight from the mice injected in panels i and j . ANOVA with Tukey’s multiple comparison test, mean ± s.d. For sg-Ctrl+Ctrl-OE and Nup KO + Ctrl-OE, n = 10 mice; for Nup KO + Ccl2-OE, n = 9 mice. l (Top) Flow cytometry analysis of CD45−/CK+ circulating tumor cells (CTCs) and (bottom) quantification of CTCs in Nup210 KD 6DT1 cell-injected animals. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test, mean ± s.d. Tumor-free, n = 3 mice; sh-Ctrl and sh-Nup # 4, n = 10 mice. m Proposed model of NUP210’s metastatic role.

    Journal: Nature Communications

    Article Title: Nuclear pore protein NUP210 depletion suppresses metastasis through heterochromatin-mediated disruption of tumor cell mechanical response

    doi: 10.1038/s41467-021-27451-w

    Figure Lengend Snippet: a Cytokine analysis and quantification of boxed cytokines of supernatants from sh-Ctrl and Nup210 KD 4T1 cells. b qRT-PCR analysis of Ccl2 KD in 4T1 cells. c Western blot of p-FAK Y397 and T-FAK proteins in Ccl2 KD 4T1 cells. d p-FAK (Y397) focal adhesion and F-actin distribution in sh-Ctrl and Ccl2 KD 4T1 cells. Scale bar = 10 μm. e Quantification of focal adhesion area, count, and cell spreading in sh-Ctrl and Ccl2 KD 4T1 cells. ANOVA with Tukey’s multiple comparison correction, box represents 25th to 75th percentile, whiskers represent data range, and the horizontal line represents median. ‘ n ’ equals the number of cells analyzed. f Cell migration tracks and quantification of sh-Ctrl and Ccl2 KD 4T1 cells. Average cell speed analyzed by ANOVA with Dunnet’s multiple comparison test, mean ± s.e.m. ‘ n ’ equals the number of independent replicates. g Brightfield images and quantification of cell area of 4T1 Nup210 KO cells treated with Ccl2. ANOVA with Tukey’s multiple comparison correction, box represents 25th to 75th percentile, whiskers represent data range, and the horizontal line represents median. ‘ n ’ equals the number of cells analyzed. h Western blot and signal quantification of Ccl2 overexpression in Nup210 KO 4T1 cells. i Tumor weight of mice injected with Ccl2 -overexpressing Nup210 KO 4T1 cells. ANOVA with Tukey’s multiple comparison correction, mean ± s.d. For sg-Ctrl+Ctrl-OE and Nup KO + Ctrl-OE, n = 10 mice; for Nup KO + Ccl2-OE, n = 9 mice. ( j ) Representative lung images from the mice from ( i ). k Lung metastases count and metastasis normalized to tumor weight from the mice injected in panels i and j . ANOVA with Tukey’s multiple comparison test, mean ± s.d. For sg-Ctrl+Ctrl-OE and Nup KO + Ctrl-OE, n = 10 mice; for Nup KO + Ccl2-OE, n = 9 mice. l (Top) Flow cytometry analysis of CD45−/CK+ circulating tumor cells (CTCs) and (bottom) quantification of CTCs in Nup210 KD 6DT1 cell-injected animals. Kruskal–Wallis ANOVA with Dunn’s multiple comparison test, mean ± s.d. Tumor-free, n = 3 mice; sh-Ctrl and sh-Nup # 4, n = 10 mice. m Proposed model of NUP210’s metastatic role.

    Article Snippet: For CRISPR/Cas9-mediated knockout of mouse Nup210 in the 4T1 cell line, single-guide RNA (sgRNA) targeting Nup210 exon 5 (sgRNA sequence: GCGACACCATCCTAGTGTCT) was designed using the GPP Web Portal available at the Broad Institute ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ). sgRNA was then cloned into the lentiGuide-puro (Addgene plasmid # 52963, a gift from the Feng Zhang lab) vector.

    Techniques: Quantitative RT-PCR, Western Blot, Comparison, Migration, Over Expression, Injection, Flow Cytometry

    Figure 1. HDAC6 knockdown (KD) sensitizes several NSCLC cell lines to ionizing radiation (IR). (A) Smaller fractions of viable cells were found in the A549 HDAC6 KD (HD6 KD) cell line as compared to the A549 control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in A549 cells. Right panel: 120 h post-IR, A549 control and HDAC6 stable knockdown cells were suspended in trypan blue. The number of unstained cells (viable), stained cells (non-viable), and total numbers were recorded. Three biological replicates are graphed. Student’s t-tests were performed. * p = 0.0122, ** p = 0.0099, *** p = 0.0021. (B) Smaller fractions of viable cells were found in the H460 HD6 KD cell line as compared to the control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in H460 cells. Right panel: H460 stable HDAC6 knockdown cells were either left untreated, or treated with 10 Gy IR. 120 h later, trypan blue staining was conducted as described in (A). Student’s t tests were performed; * p = 0.0154. (C) Smaller fractions of viable cells were

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 1. HDAC6 knockdown (KD) sensitizes several NSCLC cell lines to ionizing radiation (IR). (A) Smaller fractions of viable cells were found in the A549 HDAC6 KD (HD6 KD) cell line as compared to the A549 control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in A549 cells. Right panel: 120 h post-IR, A549 control and HDAC6 stable knockdown cells were suspended in trypan blue. The number of unstained cells (viable), stained cells (non-viable), and total numbers were recorded. Three biological replicates are graphed. Student’s t-tests were performed. * p = 0.0122, ** p = 0.0099, *** p = 0.0021. (B) Smaller fractions of viable cells were found in the H460 HD6 KD cell line as compared to the control cell line upon IR treatment. Left panel: Western blot confirming HDAC6 knockdown in H460 cells. Right panel: H460 stable HDAC6 knockdown cells were either left untreated, or treated with 10 Gy IR. 120 h later, trypan blue staining was conducted as described in (A). Student’s t tests were performed; * p = 0.0154. (C) Smaller fractions of viable cells were

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Knockdown, Control, Western Blot, Staining

    Figure 2. HDAC6 knockdown A549 cells arrest at G2/M phase post-IR. (A) A549 control cells (Ctrl) and A549 HDAC6 stable knockdown cells (HD6 KD) were either left untreated (No Tx, blue histograms) or irradiated with 10 Gy, incubated for 72 h (red histograms), harvested, ethanol fixed, and stained with PI. Cells were then analyzed via flow cytometry. (B) Analysis of the fractions of sub-G1 cells present in the experiments described in (A). Statistical significance was assessed using Student’s t test, with * p < 0.05. (C) Analysis of the cell cycle distribution from the experiments described in (A). (D) A549 control and HDAC6 stable knockdown cells were treated with 10 Gy IR at the indicated time points, and then the cells were stained with immunofluorescence for cyclin A. Results of cyclin A positivity from three biological replicates in these two cell lines were assessed for statistical significance using Student’s t test, with * p < 0.05 and ** p < 0.01. (E) Representative images of the data graphed in (D).

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 2. HDAC6 knockdown A549 cells arrest at G2/M phase post-IR. (A) A549 control cells (Ctrl) and A549 HDAC6 stable knockdown cells (HD6 KD) were either left untreated (No Tx, blue histograms) or irradiated with 10 Gy, incubated for 72 h (red histograms), harvested, ethanol fixed, and stained with PI. Cells were then analyzed via flow cytometry. (B) Analysis of the fractions of sub-G1 cells present in the experiments described in (A). Statistical significance was assessed using Student’s t test, with * p < 0.05. (C) Analysis of the cell cycle distribution from the experiments described in (A). (D) A549 control and HDAC6 stable knockdown cells were treated with 10 Gy IR at the indicated time points, and then the cells were stained with immunofluorescence for cyclin A. Results of cyclin A positivity from three biological replicates in these two cell lines were assessed for statistical significance using Student’s t test, with * p < 0.05 and ** p < 0.01. (E) Representative images of the data graphed in (D).

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Knockdown, Control, Irradiation, Incubation, Staining, Cytometry

    Figure 3. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-IR. A549 control and HDAC6 knockdown cells were irradiated with a dose of 10 Gy, harvested at the indicated time points, and the lysates were analyzed via Western blot by a series of antibodies: anti-pATR, anti-pATM, anti-p-p53S15, anti-total p53, and anti-GAPDH in (A) or by anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin (ac-tub) and anti-actin in (B). Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 1 h post-IR. The bar graphs for the expression of indicated DDR proteins are shown in (C–J).

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 3. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-IR. A549 control and HDAC6 knockdown cells were irradiated with a dose of 10 Gy, harvested at the indicated time points, and the lysates were analyzed via Western blot by a series of antibodies: anti-pATR, anti-pATM, anti-p-p53S15, anti-total p53, and anti-GAPDH in (A) or by anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin (ac-tub) and anti-actin in (B). Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 1 h post-IR. The bar graphs for the expression of indicated DDR proteins are shown in (C–J).

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Control, Knockdown, Irradiation, Western Blot, Expressing

    Figure 4. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-Etoposide treatment. (A) A549 control and HDAC6 knockdown cells were treated with 20 µM Etoposide, harvested at the indicated time points, and the lysates were analyzed via Western blot by a series of antibodies: anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin, and anti-GAPDH. Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 6 h post-Etoposide. The bar graphs for the expression of indicated DDR proteins are shown in (B–E).

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 4. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-Etoposide treatment. (A) A549 control and HDAC6 knockdown cells were treated with 20 µM Etoposide, harvested at the indicated time points, and the lysates were analyzed via Western blot by a series of antibodies: anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin, and anti-GAPDH. Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 6 h post-Etoposide. The bar graphs for the expression of indicated DDR proteins are shown in (B–E).

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Control, Knockdown, Western Blot, Expressing

    Figure 5. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-Cisplatin treatment. (A) A549 control and HDAC6 knockdown cells were treated with 10 µM Cisplatin, harvested at the indicated time points, and lysates were analyzed via Western blot by a series of antibodies: anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin, and anti-GAPDH. Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 24 h post-Cisplatin treatment, except for the pS317Chk1 bands whose normalization was chosen randomly. The bar graphs for the expression of indicated DDR proteins are shown in (B–E).

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 5. Examination of DDR markers in A549 control and A549 HDAC6 knockdown cells post-Cisplatin treatment. (A) A549 control and HDAC6 knockdown cells were treated with 10 µM Cisplatin, harvested at the indicated time points, and lysates were analyzed via Western blot by a series of antibodies: anti-pS317Chk1, anti-pS345Chk1, anti-total Chk1, anti-γ-H2AX, anti-acetylated tubulin, and anti-GAPDH. Blots were quantified via ImageJ, and reported quantification was normalized to the signal of the A549 control cells 24 h post-Cisplatin treatment, except for the pS317Chk1 bands whose normalization was chosen randomly. The bar graphs for the expression of indicated DDR proteins are shown in (B–E).

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Control, Knockdown, Western Blot, Expressing

    Figure 6. The depletion or inhibition of Chk1 in HDAC6 knockdown A549 cells restores radio-resistance. (A) Establishment of Chk1 knockdown cells in A549 HDAC6 knockdown cells (termed HDAC6KD+Tripz) was described in the Methods. Anti-HDAC6 and anti-Chk1 Western blotting analyses were performed to confirm the efficacy of HDAC6 and Chk1 double knockdown. Anti-pCDC25C, anti-ac-tub, and anti-GAPDH Western blotting analyses were also performed. Representative images of the data graphed Blots were quantified via ImageJ. For HDAC6, the reported quantification was normalized to the signal of the Control group. For the rest of the proteins, the reported quantification was normalized to the signal of the HDAC6 knockdown group. HDAC6KD+Tripz and HDAC6KD cells were plated in triplicate at a concentration of 150 cells/well and treated with the indicated dose of radiation. Cells were incubated for 12 days, fixed with crystal violet. The representative images are shown in (B). The colonies were quantified. Student t test, * p < 0.05, ** p < 0.0008. A bar graph presenting the above colony formation assays is shown in (C). HDAC6KD+Tripz and HDAC6KD cells were treated with 5Gy IR, and the immunofluorescence for Cyclin A was conducted. Representative images are shown in (D). Results of Cyclin A positivity from three experimental replicates, with significance assessed using student’s t test, with * p < 0.01, ** p = 0.0001. A bar graph representing cyclin A positive cells is shown in (E). (F) A549 HDAC6 stable knockdown cells were pre-treated with 0.25 µM of potent Chk1 inhibitor CHIR-124 prior to 10 Gy irradiation. At the indicated time points, cells were harvested and probed for the indicated proteins via Western blot. Blots were quantified via ImageJ, and normalized to the signal of the 0 h timepoint of the HDAC6 knockdowns treated with IR alone.

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 6. The depletion or inhibition of Chk1 in HDAC6 knockdown A549 cells restores radio-resistance. (A) Establishment of Chk1 knockdown cells in A549 HDAC6 knockdown cells (termed HDAC6KD+Tripz) was described in the Methods. Anti-HDAC6 and anti-Chk1 Western blotting analyses were performed to confirm the efficacy of HDAC6 and Chk1 double knockdown. Anti-pCDC25C, anti-ac-tub, and anti-GAPDH Western blotting analyses were also performed. Representative images of the data graphed Blots were quantified via ImageJ. For HDAC6, the reported quantification was normalized to the signal of the Control group. For the rest of the proteins, the reported quantification was normalized to the signal of the HDAC6 knockdown group. HDAC6KD+Tripz and HDAC6KD cells were plated in triplicate at a concentration of 150 cells/well and treated with the indicated dose of radiation. Cells were incubated for 12 days, fixed with crystal violet. The representative images are shown in (B). The colonies were quantified. Student t test, * p < 0.05, ** p < 0.0008. A bar graph presenting the above colony formation assays is shown in (C). HDAC6KD+Tripz and HDAC6KD cells were treated with 5Gy IR, and the immunofluorescence for Cyclin A was conducted. Representative images are shown in (D). Results of Cyclin A positivity from three experimental replicates, with significance assessed using student’s t test, with * p < 0.01, ** p = 0.0001. A bar graph representing cyclin A positive cells is shown in (E). (F) A549 HDAC6 stable knockdown cells were pre-treated with 0.25 µM of potent Chk1 inhibitor CHIR-124 prior to 10 Gy irradiation. At the indicated time points, cells were harvested and probed for the indicated proteins via Western blot. Blots were quantified via ImageJ, and normalized to the signal of the 0 h timepoint of the HDAC6 knockdowns treated with IR alone.

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Inhibition, Knockdown, Western Blot, Control, Concentration Assay, Incubation, Irradiation

    Figure 7. HDAC6 influences Chk1 protein stability. (A) (From left to right) A549 HDAC6 KO cells generated with the CRISPR-Cas9 system. H157 and H1975 HDAC6 KO cells generated with the CRISPR-Cas9 system. H1299 and A549 inducible HDAC6 knockdown cells (termed H1299i and A549i, respectively) pre-treated with doxycycline for two weeks. Mouse embryonic fibroblasts (MEFs) harvested from age-matched wild-type and HDAC6 KO mice (both from a C57Bl/6 background). Liver, kidney, lung, heart, spleen, and brain tissue harvested from age-matched wild type and transgenic HDAC6 KO mice (both from a C57Bl/6 background). All cell lines and tissues were lysed and analyzed

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 7. HDAC6 influences Chk1 protein stability. (A) (From left to right) A549 HDAC6 KO cells generated with the CRISPR-Cas9 system. H157 and H1975 HDAC6 KO cells generated with the CRISPR-Cas9 system. H1299 and A549 inducible HDAC6 knockdown cells (termed H1299i and A549i, respectively) pre-treated with doxycycline for two weeks. Mouse embryonic fibroblasts (MEFs) harvested from age-matched wild-type and HDAC6 KO mice (both from a C57Bl/6 background). Liver, kidney, lung, heart, spleen, and brain tissue harvested from age-matched wild type and transgenic HDAC6 KO mice (both from a C57Bl/6 background). All cell lines and tissues were lysed and analyzed

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Generated, CRISPR, Knockdown, Transgenic Assay

    Figure 8. HDAC6 ubiquitinates Chk1 in vitro and in vivo. (A) HDAC6 ubiquitinates Chk1 in vitro. (A) The in vitro Ub assays were carried out in the presence of E1, E2, Ub, His-Chk1, Flag-HDAC6 in the absence or presence of ATP. The reactions were incubated at 37 ◦C for 2 h, denatured at 95 ◦C for 5 min, then added protein loading buffer. The reactions were loaded into SDS-PAGE followed by Western blotting analysis with the anti-Chk1 antibody. The detailed protocol is described in the Methods and Zhang et al. [22] (B) The Flag-HDAC6 was transfected into 293T cells. The Flag-HDAC6 protein was then isolated anti-Flag M2 agarose followed by Coomassie Blue staining. (C). His-Chk1 was purified from E. coli with Ni-NTA beads followed by Coomassie Blue staining. (D) HDAC6 ubiquitinates Chk1 in vivo. Mammalian expression vectors containing Myc-Chk1, Flag-HDAC6, and His-Ub were transfected into 293T cells. Cells were incubated for 48 h, harvested, and passed through a Ni-NTA column to pull down for His-Ub. Bound proteins were subsequently eluted from the columns, run on an SDS-PAGE gel, and probed for Chk1.

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 8. HDAC6 ubiquitinates Chk1 in vitro and in vivo. (A) HDAC6 ubiquitinates Chk1 in vitro. (A) The in vitro Ub assays were carried out in the presence of E1, E2, Ub, His-Chk1, Flag-HDAC6 in the absence or presence of ATP. The reactions were incubated at 37 ◦C for 2 h, denatured at 95 ◦C for 5 min, then added protein loading buffer. The reactions were loaded into SDS-PAGE followed by Western blotting analysis with the anti-Chk1 antibody. The detailed protocol is described in the Methods and Zhang et al. [22] (B) The Flag-HDAC6 was transfected into 293T cells. The Flag-HDAC6 protein was then isolated anti-Flag M2 agarose followed by Coomassie Blue staining. (C). His-Chk1 was purified from E. coli with Ni-NTA beads followed by Coomassie Blue staining. (D) HDAC6 ubiquitinates Chk1 in vivo. Mammalian expression vectors containing Myc-Chk1, Flag-HDAC6, and His-Ub were transfected into 293T cells. Cells were incubated for 48 h, harvested, and passed through a Ni-NTA column to pull down for His-Ub. Bound proteins were subsequently eluted from the columns, run on an SDS-PAGE gel, and probed for Chk1.

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: In Vitro, In Vivo, Incubation, SDS Page, Western Blot, Transfection, Isolation, Staining, Expressing

    Figure 9. HDAC6 and Chk1 physically interact. (A,B) Mammalian expression vectors containing Flag-Chk1 and HA-HDAC6 were transfected into 293T cells with PEI. 48 h after overexpression, cells were harvested in lysis buffer, incubated with either HA-coated (A) or Flag-coated (B) agarose beads, and the resultant immunoprecipitated protein was run on an SDS-page gel and probed for the reciprocal tag. (C) 293T lysates were probed with anti-Chk1 antibody complexed with protein A/G beads, the beads were washed, and the resulting milieu probed for HDAC6 to detect an endogenous interaction between Chk1 and HDAC6. (D) His-Chk1 was overexpressed in E. coli. His-Chk1 was purified with Ni-NTA agarose beads. Then, GST and GST-HDAC6 were overexpressed in E. coli, and GST-tagged protein was pulled-down and purified by glutathione-agarose. Purified His-Chk1 was incubated with either glutathione agarose-bound GST or GST-HDAC6, and then bound proteins were eluted. The samples were subjected to SDS-PAGE and Western blot analysis.

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 9. HDAC6 and Chk1 physically interact. (A,B) Mammalian expression vectors containing Flag-Chk1 and HA-HDAC6 were transfected into 293T cells with PEI. 48 h after overexpression, cells were harvested in lysis buffer, incubated with either HA-coated (A) or Flag-coated (B) agarose beads, and the resultant immunoprecipitated protein was run on an SDS-page gel and probed for the reciprocal tag. (C) 293T lysates were probed with anti-Chk1 antibody complexed with protein A/G beads, the beads were washed, and the resulting milieu probed for HDAC6 to detect an endogenous interaction between Chk1 and HDAC6. (D) His-Chk1 was overexpressed in E. coli. His-Chk1 was purified with Ni-NTA agarose beads. Then, GST and GST-HDAC6 were overexpressed in E. coli, and GST-tagged protein was pulled-down and purified by glutathione-agarose. Purified His-Chk1 was incubated with either glutathione agarose-bound GST or GST-HDAC6, and then bound proteins were eluted. The samples were subjected to SDS-PAGE and Western blot analysis.

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Expressing, Transfection, Over Expression, Lysis, Incubation, Immunoprecipitation, SDS Page, Western Blot

    Figure 10. HDAC6 interacts with Chk1 via its DAC1 domain. (A) The indicated Flag-tagged HDAC6 deletion mutant constructs were transfected into 293T cells along with Myc-Chk1. 48 h later, cells were lysed, and lysates were pulled down for Flag. (B) Schematic of the Flag-tagged HDAC6 deletion mutant constructs used for the co-immunoprecipitation in (A). (C) The indicated Myc-tagged Chk1 deletion mutant constructs were transfected into 293T cells along with Flag-HDAC6. 48 h later, cells were lysed, and lysates pulled down for Flag. (D) Schematic of the Myc-tagged Chk1 deletion constructs used for the co-immunoprecipitation in (C).

    Journal: Cells

    Article Title: HDAC6 Regulates Radiosensitivity of Non-Small Cell Lung Cancer by Promoting Degradation of Chk1.

    doi: 10.3390/cells9102237

    Figure Lengend Snippet: Figure 10. HDAC6 interacts with Chk1 via its DAC1 domain. (A) The indicated Flag-tagged HDAC6 deletion mutant constructs were transfected into 293T cells along with Myc-Chk1. 48 h later, cells were lysed, and lysates were pulled down for Flag. (B) Schematic of the Flag-tagged HDAC6 deletion mutant constructs used for the co-immunoprecipitation in (A). (C) The indicated Myc-tagged Chk1 deletion mutant constructs were transfected into 293T cells along with Flag-HDAC6. 48 h later, cells were lysed, and lysates pulled down for Flag. (D) Schematic of the Myc-tagged Chk1 deletion constructs used for the co-immunoprecipitation in (C).

    Article Snippet: Briefly, the guide RNA targeting HDAC6 exon 5 (5′-GAAAGGACACGCAGCGATCT-3′) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961).

    Techniques: Mutagenesis, Construct, Transfection, Immunoprecipitation